Genetic and functional evidence for gp130/IL6ST-induced TRPA1 upregulation in uninjured but not injured neurons in a mouse model of neuropathic pain

Genetic and functional evidence for gp130/IL6ST-induced TRPA1 upregulation in uninjured but not injured neurons in a mouse model of neuropathic pain

Peripheral nerve accidents end in pronounced alterations in dorsal root ganglia (DRG), which might result in the event of neuropathic ache. Though the polymodal mechanosensitive transient receptor potential ankyrin 1 ion channel (TRPA1) is rising as a related goal for potential analgesic therapies, preclinical research don’t present unequivocal mechanistic perception into its relevance for neuropathic ache pathogenesis.
By using a transgenic mouse mannequin with a conditional depletion of the interleukin-6 sign transducer gp130 in Nav1.eight expressing neurons (SNS-gp130-/-), we offer a mechanistic regulatory hyperlink between IL-6/gp130 and TRPA1 within the spared nerve damage mannequin (SNI).
SNI mice developed profound mechanical hypersensitivity as indicated by elevated responses within the von Frey behavioral check in vivo, in addition to a big improve in mechanosensitivity of unmyelinated nociceptive major afferents in ex vivo pores and skin nerve recordings.
In distinction to wild sort and management gp130fl/fl animals, SNS-gp130-/- mice didn’t develop mechanical hypersensitivity after SNI and exhibited low ranges of Trpa1 mRNA in sensory neurons, which had been partially restored by adenoviral gp130 re-expression in vitro.
Importantly, unhurt however not injured neurons developed elevated responsivenesshe TRPA1 to t agonist cinnamon aldehyde (CA), and neurons derived from SNS-gp130-/- mice after SNI had been considerably much less attentive to CA. Our research exhibits for the primary time that TRPA1 upregulation is attributed particularly to unhurt neurons within the SNI mannequin and this relied on the IL-6 sign transducer gp130.
We offer an answer to the enigma of TRPA1 regulation following nerve damage and stress its significance as an essential goal for neuropathic ache problems.

Era and Surgical Evaluation of Genetic Mouse Fashions to Research NF-κB-Pushed Pathogenesis of Diffuse Giant B Cell Lymphoma

Enforced activation of NF-κB signaling will be achieved by constitutive NF-κB-inducing kinases, IKK2 and NIK, or through lymphoma-associated mutants of MYD88, CARD11, and CD79B. With a view to mannequin Diffuse Giant B Cell Lymphoma (DLBCL) in mice, conditional alleles for these proteins are mixed with alleles focusing on Cre recombinase expression in mature B cells.
Nonetheless, unopposed NF-κB signaling promotes plasmablast differentiation, and as a consequence the mannequin system have to be complemented with additional mutations that block differentiation, resembling Prdm1/BLIMP1 inactivation or overexpression of BCL6. Right here, we describe the presently out there instruments for DLBCL fashions in mice and their relative benefits and disadvantages.
Moreover, we describe strategies to observe lymphomagenesis, utilizing ultrasound tomography of the spleen, and the strategy of partial splenectomy surgical procedure with restoration. These highly effective strategies enable paired comparability of particular person lymphoma circumstances earlier than and after interventions, together with therapies, and to review the evolution of lymphoma over time.
NF-κB activation additionally promotes widespread nodal involvement with lymphoma and we describe the autopsy dissection of main nodal teams.

Induction of Stress-Induced Renal Mobile Senescence In Vitro: Impression of Mouse Pressure Genetic Range

Mobile senescence, a stress-induced state of irreversible cell cycle arrest, is related to organ dysfunction and age-related illness. Whereas immortalized cell strains bypass key pathways of senescence, essential mechanisms of mobile senescence will be studied in major cells. Main tubular epithelial cells (PTEC) derived from mouse kidney are extremely prone to develop mobile senescence, offering a useful software for finding out such mechanisms.
Right here, we examined whether or not genetic variations between mouse inbred strains have an effect on the event of stress-induced mobile senescence in cultured PTEC. Kidneys from 129S1, B6, NOD, NZO, CAST, and WSB mice had been used to isolate PTEC.
Cells had been monitored for expression of typical senescence markers (SA-β-galactosidase, γ-H2AX+/Ki67-, expression ranges of CDKN2A, lamin B1, IL-1a/b, IL-6, G/M-CSF, IFN-g, and KC) at three and 10 days after pro-senescent gamma irradiation. Clear variations had been discovered between PTEC from completely different strains with the best senescence values for PTEC from WSB mice and the bottom for PTEC from 129S1 mice.
PTEC from B6 mice, probably the most generally used inbred pressure in senescence analysis, had a senescence rating decrease than PTEC from WSB and CAST mice however increased than PTEC from NZO and 129S1 mice. These knowledge present new info relating to the affect of genetic variety and assist clarify heterogeneity in present knowledge.
The noticed variations must be thought-about when designing new experiments and would be the foundation for additional investigation with the aim of figuring out candidate loci driving pro- or anti-senescent pathways.

Combining Human Illness Genetics and Mouse Mannequin Phenotypes in the direction of Drug Repositioning for Parkinson’s illness.

Parkinson’s illness (PD) is a extreme neurodegenerative dysfunction with out efficient therapies. Right here, we current a novel drug repositioning method to foretell new medication for PD leveraging each illness genetics and huge quantities of mouse mannequin phenotypes.
First, we recognized PD-specific mouse phenotypes utilizing well-studied human illness genes. Then we searched all FDA-approved medication for candidates that share comparable mouse phenotype profiles with PD. We demonstrated the validity of our method utilizing medication which have been authorized for PD: 10 authorized PD medication had been ranked inside high 10% amongst 1197 candidates.
In predicting novel PD medication, our method achieved a imply common precision of 0.24, which is considerably increased (p<e-11) than 0.16 for a state-of-art drug discovery method primarily based on mouse phenotype knowledge. Comparability of gene expression profiles between PD and top-ranked drug candidates signifies that quetiapine has the potential to deal with PD.
Genetic and functional evidence for gp130/IL6ST-induced TRPA1 upregulation in uninjured but not injured neurons in a mouse model of neuropathic pain

Genetic backgrounds and modifier genes of NTD mouse fashions: A chance for better understanding of the multifactorial etiology of neural tube defects.

Neurulation, the early embryonic means of forming the presumptive mind and spinal twine, is extremely complicated and entails tons of of genes in a number of genetic pathways. Mice have lengthy served as a genetic mannequin for finding out human neurulation, and the ensuing neural tube defects (NTDs) that come up when neurulation is disrupted.
As a result of mice seem to indicate principally single gene inheritance for NTDs and people present multifactorial inheritance, mice typically have been characterised as a less complicated mannequin for the identification and research of NTD genes.
However are they a easy mannequin? When considered on completely different genetic backgrounds, many genes present important variation within the penetrance and expressivity of NTD phenotypes, suggesting the presence of modifier loci that work together with the goal gene to have an effect on the phenotypic expression.
Taking a look at mutations on completely different genetic backgrounds gives us with a possibility to discover these complicated genetic interactions, that are prone to higher emulate comparable processes in human neurulation. Right here, we evaluation NTD genes identified to indicate strain-specific phenotypic variation.
We focus notably on the gene Cecr2, which is studied utilizing each a hypomorphic and a presumptive null mutation on two completely different backgrounds: one prone (BALB/c) and one resistant (FVB/N) to NTDs. This pressure distinction has led to a seek for genetic modifiers inside a area on murine chromosome 19.

GRO / KC (CXCL1) Protein

20-abx260684
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

GRO / KC (CXCL1) Protein

20-abx261870
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

GRO1/KC Mouse Recombinant Protein (CXCL1)

PROTP12850-1 Regular: 20ug
EUR 317
Description: KC Mouse Recombinant also known as N51 and GRO1 produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 77 amino acids and having a molecular mass of approximately 8 kDa.;The GRO-1 is purified by proprietary chromatographic techniques.

Recombinant Mouse (E.Coli) GRO/KC (CXCL1)

RP-1037 5 ug
EUR 164

GRO/KC (CXCL1), Rat Recombinant

P1288-25
EUR 370

GRO/KC (CXCL1), Rat Recombinant

P1288-5
EUR 175

Recombinant Murine KC (CXCL1) Protein

PROTP12850-2 20ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant murine KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

GRO, KC, CXCL1, rRtGRO, rat

RC352-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

GRO1/KC Mouse, GRO/KC (CXCL1) Mouse Recombinant Protein, His Tag

PROTP12850 Regular: 20ug
EUR 317
Description: GRO1/KC Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 97 amino acids (25-96 a.a.) and having a molecular mass of 10.5kDa.;GRO1 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GRO-alpha, KC, CXCL1 (rMuKC), murine (mouse)

RC332-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Recombinant Rat GRO/KC (CXCL1) Protein

PROTP14095-1 25ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant rat GRO/KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

Rat CXCL1/CINC-1/KC ELISA Kit

RK00196 96 Tests
EUR 521

KC protein (Mouse)

30R-AK001 20 ug
EUR 273
Description: Purified recombinant Mouse KC protein

Anti-CXCL1 antibody

STJ28366 100 µl
EUR 277
Description: This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4.

Anti-CXCL1 antibody

STJ72026 100 µg
EUR 260

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Rabbit Anti Mouse Cxcl1 Polyclonal Antibody

CPBT-65100RM 0.1 mg
EUR 881

KC antibody

20R-1786 100 ug
EUR 651
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12297 100 ug
EUR 527
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12298 100 ug
EUR 492
Description: Rabbit polyclonal KC antibody

KC Antibody

5211-100
EUR 376

KC Antibody

5212-100
EUR 392

KC Antibody

5212-30T
EUR 146

KC antibody

70R-KR006 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal KC antibody

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90006 20 ug
EUR 1025
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90007 100 ug
EUR 2725
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

Anti-GRO alpha/Cxcl1 Antibody

A00533 100ug/vial
EUR 294

Anti-GRO alpha/CXCL1 Antibody

PA1760 100ug/vial
EUR 294

KC Blocking Peptide

33R-11041 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KC antibody, catalog no. 70R-12298

KC Blocking Peptide

5212BP-50
EUR 153

Polyclonal KC Antibody

APR16969G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KC . This antibody is tested and proven to work in the following applications:

KC 12291 hydrochloride

B7332-10 10 mg
EUR 373

KC 12291 hydrochloride

B7332-50 50 mg
EUR 1363

Mouse CXCL1 ELISA Kit

55R-1741 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory

Mouse CXCL1 shRNA Plasmid

20-abx970673
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GRO-alpha/CXCL1, Mouse

HY-P7188 50ug
EUR 533

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CXCL1 protein

30R-3156 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein

CXCL1 antibody

70R-16681 50 ul
EUR 435
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-10502 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-14297 100 ug
EUR 327
Description: Affinity purified Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-15473 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 Antibody

33054-100ul 100ul
EUR 252

CXCL1 Antibody

43679-100ul 100ul
EUR 252

CXCL1 Antibody

1-CSB-PA006239GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CXCL1 Antibody

1-CSB-PA06097A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Cxcl1 Antibody

1-CSB-PA09217A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

CXCL1/GRO

E21-597 10ug
EUR 343

CXCL1/GRO

EF012822 96 Tests
EUR 689

CXCL1 Antibody

1-CSB-PA009036
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

CXCL1 siRNA

20-abx901350
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CXCL1 siRNA

20-abx913248
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CXCL1 siRNA

20-abx913249
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pEGFP- CXCL1

PVT10178 2 ug
EUR 301

Rabbit Anti Rat Cxcl1 Polyclonal Antibody

CPBT-65101RR 0.1 mg
EUR 881

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

KiloGreen 2X qPCR MasterMix-iCycler

MasterMix-KC 4 x 1.25 ml - 500 reactions (20 ul)
EUR 140

GRO/KC, murine recombinant

4210-100
EUR 773

GRO/KC, murine recombinant

4210-1000
EUR 3856

GRO/KC, murine recombinant

4210-20
EUR 256

Mouse CXCL1 Detection Assay Kit

6725 1 kit
EUR 483.55
Description: Mouse CXCL1 Detection Assay Kit

CXCL1 protein (Mouse) (His tag)

80R-3368 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

CXCL1 protein (Mouse) (His tag)

80R-3439 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

ELISA kit for Mouse CXCL1

EK5299 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CXCL1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse CXCL1 PicoKine ELISA Kit

EK0723 96 wells
EUR 456
Description: For quantitative detection of mouse CXCL1 in cell culture supernates and serum.

Mouse CXCL1/GROα ELISA kit

LF-EK50473 1×96T
EUR 648

Cxcl1 ORF Vector (Mouse) (pORF)

ORF042286 1.0 ug DNA
EUR 95

CXCL1 ELISA Kit (Mouse) (OKAN04583)

OKAN04583 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.0 pg/mL

CXCL1 ELISA Kit (Mouse) (OKBB00312)

OKBB00312 96 Tests
EUR 544
Description: Description of target: Chemokine (C-X-C motif) ligand 1 (CXCL1) is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GROα, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-α). In humans, this protein is encoded by the CXCL1 gene. The gene for CXCL1 is located on human chromosome 4 amongst genes for other CXC chemokines. The mature form of CXCL1 is maximally 73 amino acids long. CXCL1 is secreted by human melanoma cells, has mitogenic properties and is implicated in melanoma pathogenesis. CXCL1 is expressed by macrophages, neutrophils and epithelial cells, and has neutrophil chemoattractant activity. This chemokine elicits its effects by signaling through the chemokine receptor CXCR2.CXCL1 decreased the severity of multiple sclerosis and may offer a neuro-protective function. The standard product used in this kit is recombinant mouse CXCL1, consisting of 77 amino acids with the molecular mass of 8KDa.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 1 pg/ml

CXCL1 ELISA Kit (Mouse) (OKCD05712)

OKCD05712 96 Wells
EUR 609
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.0pg/mL

KC ELISA Kit (Mouse) : 96 Wells (OKAG00090)

OKAG00090 96 Wells
EUR 596
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 8 pg/mL

CXCL1 Blocking Peptide

33R-7741 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL1 antibody, catalog no. 70R-10502

CXCL1 antibody (HRP)

60R-2236 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (HRP)

CXCL1 antibody (FITC)

60R-2237 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (FITC)

CXCL1 antibody (biotin)

60R-2238 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (biotin)

CXCL1 Blocking Peptide

20-abx061039
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CXCL1 Conjugated Antibody

C33054 100ul
EUR 397

CXCL1 cloning plasmid

CSB-CL006239HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 324
  • Sequence: atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaag
  • Show more
Description: A cloning plasmid for the CXCL1 gene.

Cxcl1 Polyclonal Antibody

A51950 100 µg
EUR 570.55
Description: fast delivery possible

CXCL1 Polyclonal Antibody

A51978 100 µg
EUR 570.55
Description: kits suitable for this type of research

Recombinant Human CXCL1

P0109 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1

pCMV-SPORT6-CXCL1

PVT13291 2 ug
EUR 391

Mouse CXCL1 AssayLite Antibody (FITC Conjugate)

70027-05141 150 ug
EUR 428

Mouse Growth-regulated alpha protein (Cxcl1)

1-CSB-RP092174m
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Growth-regulated alpha protein(Cxcl1),partial expressed in E.coli

GRO-alpha/CXCL1 (CHO-expressed), Mouse

HY-P7186 50ug
EUR 337

Cxcl1 sgRNA CRISPR Lentivector set (Mouse)

K4368201 3 x 1.0 ug
EUR 339

Mouse CXCL1/GROα ELISA kit (4X96T)

LF-EK50474 4×96T
EUR 2201

Human CXCL1 ELISA Kit

55R-1740 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory

Rat CXCL1 ELISA Kit

55R-1742 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory

CXCL1 Antibody, HRP conjugated

1-CSB-PA06097B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CXCL1 Antibody, FITC conjugated

1-CSB-PA06097C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CXCL1 Antibody, Biotin conjugated

1-CSB-PA06097D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Understanding how genetic variants alter the phenotypic end result in NTD mouse fashions will assist to direct future research in people, notably now that extra genome broad sequencing approaches are getting used. Delivery Defects Analysis 109:140-152, 2017. © 2016 Wiley Periodicals, Inc.

Leave a Reply

Your email address will not be published. Required fields are marked *